Skip to main content

Table 1 This table presents the structure of the primers used, their base pair lengths and the corresponding annealing temperatures.

From: Analysis of expression profiles of MAGE-A antigens in oral squamous cell carcinoma cell lines

Gene Sequence (5'→ 3') Base pairs (bp) Annealing temp. (°C)
β-Actin for CTACGTCGCCCTGGACTTCGAGC
rev GATGGAGCCGCCGATCCACACGG
384 68
MAGE-A2 for AAGTAGGACCCGAGGCACTG
rev GAAGAGGAAGAAGCGGTCTG
236 62
MAGE-A3 for CCAAGCAGCACTCAGTAGGAAGG
rev GGAAGCTTTGCTGAAGATC
150 51
MAGE-A4 for GAGCAGACAGGCCAACCG
rev AAGGACTCTGCGTCAGGC
445 65
MAGE-A6 for GGAAGGTGGCCAAGTTGGTTC
rev CCAGCTGCAAGGAATCGGAAG
149 56
MAGE-A10 for CACAGAGCAGCACTGAAGGAG
rev CTGGGTAAAGACTCACTGTCTGG
484 60