Skip to main content

Advertisement

Table 2 The primer sequences and PCR conditions

From: Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta

Gene Primer(5' – 3') AT bp Gene Primer(5' – 3') AT bp
MMP20 F: AAGTGCAAACGTGCACTGTC 68°C ENAM F: GAGACTTGACTTGACAGCTCCTAT 60°C
Exon 1 R: GGTTTTCTAGGGCAGAGGAG 170 Exon 1 R: TCTCTAATACTCACCCAATGCC 413
MMP20 F: ACTACGCTGTAGACGCGTCA 58°C ENAM F: CAAAGACAAGCTAACAAAGTTCAA 58°C
Exon 2 R: CTCTGAATTTGCAAAGACTTG 318 Exon 1 -3 R: GCCCTCTCAAGTGTATTTCTGACA 735
MMP20 F: GAAAACATGTTCCTTCCGTT 58°C ENAM F: GCAGCTTGAAAACTACCAGATGAT 58°C
Exon 3 R: AGATGGAATCCAAGTACCAC 201 Exon 4 e 5 R: ACTTTGCCTCGATTTGAGAGTTTA 573
MMP20 F: GAAGGACTCAATCTTGTTGGC 62°C ENAM F: CACTGGGAAGTTCTAAGGTT 58°C
Exon 4 R: CCAGGTTATGGTGAATTGTGC 196 Exon 6 R: AACGGAGTTATCTAGATAAACAAG 212
MMP20 F: CCTGTGTTGATACTGTTTTTTTC 60°C ENAM F: CAGCCTGAATCACAGCTCTATT 58°C
Exon 5 R: GGGTGGTCATCAAAGAAGG 234 Exon 7 R: TTAAAAGGCAACAGTATTTGGGTA 513
MMP20 F: CCCGTTACCATTTTGACCAAC 60°C ENAM F: TTATCATTATCGTCTTTGCCCTAT 58°C
Exon 6 R: AATGAGAGTCGGTGGCGTGT 210 Exon 8 R: CCCAGTTTCCCCATTACATT 567
MMP20 F: GTAAATCAATCATTGATCTTG 56°C ENAM F: TCGAAGGTGGTTTTCTCCTGTGTT 58°C
Exon 7 R: GCCATTTCTTTCTTTGAGGG 226 Exon 9 R: AGCAGGGGCGAATGGATTGT 157
MMP20 F: GGTGCAGAGTTTTCGTAAAC 52°C ENAM F: AACACCATGGTGGGAAACAAAG 58°C
Exon 8 R: AAATAAAGATAGATAGTAAAAAGG 232 Exon 10.1 R: TTACGTTCCCAAGCAAAGAAGTTC 573
MMP20 F: CATCTACAACCAGTAAAAACC 58°C ENAM F: ACAGAATAGGCCTTTTTACAGA 60°C
Exon 9 R: GCAAAGCCAAGATTTCTTATG 223 Exon 10.2 R: ATTGGGTTATATTCAGGGTAGAA 787
AMELX F: GGATTGGTTGTTACAGATGCC 59°C ENAM F: CAAGAAGAACATTTACCCCATCCT 60°C
Exon 1 R: TGGGCCAACTAAAAAGTAAC 252 Exon 10.3 R: CATGCCATAGTTCAAATTCTCACC 753
AMELX F: TGTGTTTTATGGAGCATTCA 65°C ENAM F: AGCTGGGCTTCAGAAAAATCCAAT 60°C
Exon 2 R: TTACTCACAGGCATGGCAAAAGCTGC 148 Exon 10.4 R: AGATGGTCTTTGCTGTTGCCTCTC 709
AMELX F: CCTCCCTGTAAAAGCTACCACC 67°C ENAM F: CTCCAATCCAGAAGGCATCCAA 60°C
Exon 3 R: CTTTACAGAGCCCAGGGCATTG 126 Exon 10.5 R: CTCCACCTGGGTCGCTACTCCTAT 510
AMELX F: GTAGAACTCACATTCTCAGGC 67°C KLK4 F: GCAGCTTTGCAGTCACAAGC 58°C
Exon 4e 5 R: AATGTCTACATACCGGTGGCC 292 Exon 1 R: AGGGACAAAGAGAGGGATGG 150
AMELX F: GTAGAACTCACATTCTCAGGC 67°C KLK4 F: TGACTGCTCCTGAACCTCTG 58°C
Exon 6 R: GGCTTCAAAATATACTCACCACTTCC 994 Exon 2 R: ATGAGCCTGATATTAGGCCC 334
AMELX F: CATCTACAACCAGTAAAAACC 67°C KLK4 F: TTCTCCACCCTTCCCTGAGT 58°C
Exon7 R: GCAAAGCCAAGATTTCTTATG 223 Exon 3 e 4 R: TGCCACAAAACTGACCTGCC 555
AMBN F: ATTGCAGGAGCAGAGATTCC 58°C KLK4 F: GAATTCTGACTCTCCCTCTC 58°C
Exon 1 R: TGGGTGTTAGGCATGTCATC 395 Exon 5 R: GGTCAATTTCATGGGTTCCC 214
AMBN F: CCTTTATCCCGGTGGTTTTT 58°C Amelotin F: CTGCAGCTAATAACCCACCTAATGA 58°C
Exon 2 R: CGCTTTTGGATTGCAAGACT 365 Exon 1 e 2 R: AATTGACCTTTTACCACGATGGA 636
AMBN F: CTTCTTCATTCTGCCCAAGC 58°C Amelotin F: GGGCTGGCATTTTTCCACTCTACAT 58°C
Exon 3 R: TGCAGTAGAATTATAAGACAAAGCTC 385 Exon 3 R: TTTTCCCCACTCCCAAACGA 437
AMBN F: TCCACCTTTCAGTGATGATTTG 58°C Amelotin F: CGAGGCTTCATCTTTATTTACCTTC 58°C
Exon 4 R: TTGTTTTTGTTTTTCCCTGTCA 376 Exon 4 R: CATTTGTGGATATACGCACCC 306
AMBN F: CTGGCGACAGAGCAAGATTC 58°C Amelotin F: GCAATAGCCCTTGTAGTCGTAC 58°C
Exon 5 R: TCGATTTATTTGGCACGAGA 370 Exon 5 R: GCATGGTCAGTTCTCTGGGTATGTT 496
AMBN F: TCCTAGCCTCCCTTCCAGAT 58°C Amelotin F: GGCATAGTAGCAGGCAACTGT 58°C
Exon 6 R: TTATGCCTGAAGGCTACGATT 452 Exon 6 R: ACAAAGTACATTGGAAACCTCACAA 358
AMBN F: TTGGGTCATACCTCCCAAAA 58°C Amelotin F: ATAGATCATAAGGCAGTTTAACATATT 58°C
Exon 7–9 R: TCATGGATAAATGGGACAATGA 670 Exon 7 R: TAGAAAAGTAGCTGGAGAAGTATAATG 373
AMBN F: TCATGGATAAATGGGACAATGA 58°C Amelotin F: CTCCATCTTTCCATTCCTACCCA 58°C
Exon 10–12 R: CTGAGTCCCATGATCATTTG 950 Exon 8 R: GAGTAAAAATATTCCCTCATGTTGCT 527
AMBN F: CAGCCAACTTCCTATTCTCCA 58°C Amelotin F: CTAAAGAATGATATGGATGCTCCTAAT 58°C
Exon 13 R: AAAGCAAGAAGGGGACCTACA 842 Exon 9 R: GAGACCAGAATTTGTCTTCACATTGC 567