Skip to main content

Table 2 Primers for the quantificationof human ANLN gene expression

From: ANLN promotes carcinogenesis in oral cancer by regulating the PI3K/mTOR signaling pathway

Gene symbol Primer Sequence (5′-3′) Product
ANLN Forward AGTCCTCTGAAAACGGGGGT 214 bp
Reverse GTGTGCTACGAGCTGGACTT