Skip to main content

Advertisement

Table 1 The primer’s sequences used for detection of IL-28B (rs8099917 and rs12979860) gene polymorphisms using RFLP-PCR and T-ARMS-PCR

From: The association between interleukin-28B gene polymorphisms as a potential biomarker and the risk of chronic Periodontitis in an Iranian population

Polymorphisms Primer Sequence (5’- > 3’)
rs12979860 Forward: 5’-GCTTATCGCATACGGCTAGG-3’
Reverse: 5’- AGGCTCAGGGTCAATCACAG −3’
rs8099917 Forward outer: 5’-CATCACCTATAACTTCACCATCCTCCTC-3’
Reverse outer: 5’-GGTATCAACCCCACCTCAAATTATCCTA-3’
Forward inner[G allele]: 5’-CTTTTGTTTTCCTTTCTGTGAGCAGTG-3’
Reverse inner [T allele]: 5’-TATACAGCATGGTTCCAATTTGGGTAAA-3’