Skip to main content

Table 1 Primer sequences for osteogenic differentiation analysis using reverse transcriptase-polymerase chain reaction (RT-PCR)

From: Epidermal growth factor enhances osteogenic differentiation of dental pulp stem cells in vitro

Gene Sequence of oligonucleotides (5’- 3’) Tm °C
β-Actin Forward: GGCATCCTGACCCTGAAGTA Reverse: GGGGTGTTGAAGGTCTCAAA 51
OCN Forward: GAGCCCCAGTCCCCTACC Reverse: CCGATAGAGGTCCTGAAAG 58
BSP Forward: CAGCGGAGGAGACAATGGAG Reverse: TTCAACGGTGGTGGTTTTCC 58
OPN Forward: CAACGAAAGCCATGACCACA Reverse: CAGGTCCGTGGGAAAATCAG 54
ALP Forward: GGTGAACCGCAACTGGTACT Reverse: CCCACCTTGGCTGTAGTCAT 54