Skip to main content

Table 1 Oligonucleotide primer sequences used for Real Time PCR

From: The influence of bisphosphonates on human osteoblast migration and integrin aVb3/tenascin C gene expression in vitro

  Sense Antisense
Integrin aVb3 TTGTTTCAGGAGTTCCAAGA TGAAGAGAGGTGCTCCAATA
Tenascin C GAGACATCTGTGGAAGTGGA CGTACTCAGTGTCAGGCTTC
GAPDH AAAAACCTGCCAAATATGAT CAGTGAGGGTCTCTCTCTTC
RPS 18 TCGGAACTGAGGCCATGA GAACCTCCGACTTTCGTTC
Actin GGAGCAATGATCTTGATCTT CCTTCCTGGGCATGGAGTCCT