Skip to main content

Table 1 PCR conditions of SMO exons

From: Smoothened gene alterations in keratocystic odontogenic tumors

Exon Size(bp) Forward primer sequence (5′to 3′) Reverse primer sequence (5′to 3′) Reference Annealing temperature (°C)
1 391 GGGCTGCTGCTGCTGCTG GTCCCCGCCCTCTCCAAAACT Sun et al., 2008 [25] TD60 ~ 50
2 283 AAGAACTGTCCTGCCCAGATG CCACTGGACCCTGCCCTATAC Wang et al., 2013 [12] 63
3 305 AATAATTTGCCAAGCCAGCC CTTCTGATCATGACCCTTCCC Wang et al., 2013 [12] 63
4 256 AGGGTCATGATCAGAAGGGTC AGTATGCAGTAGGGCAGAGCC Wang et al., 2013 [12] 63
5 302 CTGACTTCTGGGAACCTCCAG GACAGAAGGTGGGTTACTGGC Wang et al., 2013 [12] 63
6 206 GTGGCGCAGGTATAGTGACTG GCCCTATAGGAGCTAGCTGGG Wang et al., 2013 [12] 63
7 175 GACTCCAGAGCCTTAGGACCC TCCCTATGGCTAACTTGTCCC Wang et al., 2013 [12] 63
8 196 AAGCAGTTCTTGGACTGAGCC CCATCCATTGAATCTGCTGTC Wang et al., 2013 [12] 55
9 379 AGTTGGAAGCTGCAGTGGG CAAGGCTGTGCTAGAGGCAG Wang et al., 2013 [12] 63
10 228 CTCTGGAAAGAATGGCATCG TTCCAAATAATCTGTGTGCCC Wang et al., 2013 [12] 55
11 215 AATGGCACTGACTATGGGAGG CCACTCTTCAGATCCTCTGGG Wang et al., 2013 [12] 63
12a 292 GAGCCAGGGCCCCAGGCTCGT ACGCTCCCTGTCGGCAAGAGT Sun et al., 2008 [25] TD65-56
12b 315 AGTACCATTCCTCGACTGCCT GGTATTGGTTCCTCTCTTTCC Sun et al., 2008 [25] TD65-56